Query (optional)   in Class  

GrainGenes Marker Report: Xgwm67

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xgwm67
Type
Microsatellite
Chromosome
5B
Map
Ta-NxW-5B53
Wheat-Composite2004-5B52
[ Show Nearby Loci ]
Map Data
Wheat, Composite, 2004
Wheat, Nanda2419 x Wangshuibai
Probe
WMS67
Possible Orthologs
Xgwm67-3A
Xgwm67-5B
gwm67
gwm67-5B



Probe for Locus
WMS67
Locus
Xgwm67-5B
Xgwm67
Xgwm67-3A
gwm67
gwm67-5B
Reference
ReferenceRoder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023.
General Remarks
Insert contains repeat (CA)10
PRIMER SEQUENCE IS AVAILABLE FOR PUBLIC RESEARCH ONLY. REQUESTS FOR COMMERCIAL USE SHOULD BE DIRECTED TO M. ROEDER.
Type
PCR
SSR
PCR primers
5' ACCACACAAACAAGGTAAGCG 3'
5' CAACCCTCTTAATTTTGTTGGG 3'
Amplification Conditions
3 min at 94 deg C; 45 cycles with 1 min at 94 deg C, 1 min at 60 deg C, and 2 min at 72 deg C; and a final extension step of 10 min at 72 deg C
Polymorphism
WMS67
Source Species
Triticum aestivum
Source Germplasm
Chinese Spring
Data Source
Roeder, Marion S.98.09.15