Query (optional)   in Class  

GrainGenes Marker Report: Xgwm68-5B

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xgwm68-5B
Type
Microsatellite
Chromosome
5B
Map
Ta-SSR-2004-5B64.3
Ta-Synthetic/Opata-BARC-5B30.3
Ta-Synthetic/Opata-GPW-5B28.8
Ta-Synthetic/Opata-SSR-5B39.65
[ Show Nearby Loci ]
Map Data
Wheat, Consensus SSR, 2004
Wheat, Synthetic x Opata, BARC
Wheat, Synthetic x Opata, GPW
Wheat, Synthetic x Opata, SSR
Probe
WMS68
Reference
ReferenceSomers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114.
ReferenceRoder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023.
Data Source
Roeder, Marion S.98.09.15
Remark
In Map Ta-Synthetic/Opata-SSR-5B, the interval most likely to contain locus is between Xgwm335 and Xabc164
Possible Orthologs
Xgwm68-7B
[ Show all 7 ]



Probe for Locus
WMS68
Locus
Xgwm68-5B
[ Show all 8 ]
Reference
ReferenceRoder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023.
General Remarks
Insert contains repeat (GA)3(G)3(GA)25
PRIMER SEQUENCE IS AVAILABLE FOR PUBLIC RESEARCH ONLY. REQUESTS FOR COMMERCIAL USE SHOULD BE DIRECTED TO M. ROEDER.
Type
PCR
SSR
PCR primers
5' AGGCCAGAATCTGGGAATG 3'
5' CTCCCTAGATGGGAGAAGGG 3'
Amplification Conditions
3 min at 94 deg C; 45 cycles with 1 min at 94 deg C, 1 min at 60 deg C, and 2 min at 72 deg C; and a final extension step of 10 min at 72 deg C
Polymorphism
WMS68
Source Species
Triticum aestivum
Source Germplasm
Chinese Spring
Data Source
Roeder, Marion S.98.09.15
Korzun, Victor N.97.10