Query (optional)   in Class  

GrainGenes Marker Report: Xgwm71-3D

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xgwm71-3D
Type
Microsatellite
Chromosome
3D
Map
Chinese_Spring_Deletion_SSR_3D-0.12
[ Show all 6 ]
[ Show Nearby Loci ]
Breakpoint Interval
C-3DS3-0.24
Map Data
Wheat, Consensus SSR, 2004
[ Show all 7 ]
Probe
WMS71
Reference
ReferenceSomers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114.
ReferenceRoder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023.
Data Source
Roeder, Marion S.98.09.15
Remark
In Map Ta-Synthetic/Opata-SSR-3D, the interval most likely to contain locus is between Xcdo459 and Xgwm183
Possible Orthologs
Xgwm71
[ Show all 15 ]



Probe for Locus
WMS71
Locus
Xgwm71-2A.1
[ Show all 16 ]
Reference
ReferenceRoder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023.
General Remarks
Insert contains repeat (GT)20
PRIMER SEQUENCE IS AVAILABLE FOR PUBLIC RESEARCH ONLY. REQUESTS FOR COMMERCIAL USE SHOULD BE DIRECTED TO M. ROEDER.
Type
PCR
SSR
PCR primers
5' GGCAGAGCAGCGAGACTC 3'
5' CAAGTGGAGCATTAGGTACACG 3'
Amplification Conditions
3 min at 94 deg C; 45 cycles with 1 min at 94 deg C, 1 min at 60 deg C, and 2 min at 72 deg C; and a final extension step of 10 min at 72 deg C
Polymorphism
WMS71
Source Species
Triticum aestivum
Source Germplasm
Chinese Spring
Data Source
Roeder, Marion S.98.09.15