Query (optional)   in Class  

GrainGenes Marker Report: XksuD14A

[ Printable Version ]  [ Submit comment/correction ]

Locus
XksuD14A
Type
RFLP
Chromosome
1D
Map
Avena-Sorrells-A0
Wheat-Composite2004-1D7
[ Show Nearby Loci ]
Map Data
Diploid Oat, Cornell2
Wheat, Composite, 2004
Probe
pTtksuD14
Possible Orthologs
D014
[ Show all 26 ]



Probe for Locus
pTtksuD14
Locus
ksuD14F
[ Show all 28 ]
Type
Genomic
STS
PCR primers
R:CCAAAGAGCATCCATGGTGT
L:CGCTTTTACCGAGATTGGTC
Specificity
Primer specificity verified, maps on chromosome 1BS.
Polymorphism
KSUD14 EcoRV
Linkage Group
1D
Insert Enzyme
PstI
Source Species
Triticum tauschii
Insert Size
1.6
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
Gill, Bikram S.
Image
KSUD14 SO autoradiogram
Data Source
Talbert, Luther E.94.09.12
ATMI92.09
Gill, Bikram S.92.09