GrainGenes Marker Report: XksuE18-1D
[ Printable Version ] [ Submit comment/correction ]
| |
| |
| |
| |
| |
| |
| |
| |
| |
|  | Paillard S et al. (2003) An integrative genetic linkage map of winter wheat (Triticum aestivum L.) Theoretical and Applied Genetics 107:1235-1242. |
|
|
| |
| |
| |
| |
|  | Gill KS et al. (1991) A genetic linkage map of Triticum tauschii (DD) and its relationship to the D genome of bread wheat (AABBDD). Genome 34:362-374. |
|
|
| |
| R:TGAGCCGGTTGCTGTTCGTC L:AAGCACCGACATGGTCACCC |
|
| |
| |
| |
| |
| |
| |
| |
| |
| |
| |
| |
| |