Query (optional)   in Class  

GrainGenes Marker Report: XksuE18-1D

[ Printable Version ]  [ Submit comment/correction ]

Locus
XksuE18-1D
Type
RFLP
Chromosome
1D
Chromosome Arm
1DS
Map
Ta-Courtot/CS-GPW-1D23.6
Triticum-AxF-1D41.3
[ Show Nearby Loci ]
Map Data
Wheat, Arina x Forno
Wheat, Courtot x Chinese Spring, GPW
Species
Triticum aestivum
Probe
pTtksuE18
Reference
ReferencePaillard S et al. (2003) An integrative genetic linkage map of winter wheat (Triticum aestivum L.) Theoretical and Applied Genetics 107:1235-1242.
Possible Orthologs
DGE18
[ Show all 25 ]



Probe for Locus
pTtksuE18
Locus
XksuE18-6B
[ Show all 27 ]
Reference
ReferenceGill KS et al. (1991) A genetic linkage map of Triticum tauschii (DD) and its relationship to the D genome of bread wheat (AABBDD). Genome 34:362-374.
Type
Genomic
STS
PCR primers
R:TGAGCCGGTTGCTGTTCGTC
L:AAGCACCGACATGGTCACCC
Amplification Conditions
Anneal at 45oC
Polymorphism
KSUE18 DraI
KSUE18 HindIII
Linkage Group
1D
Insert Enzyme
PstI
Source Species
Triticum tauschii
Source Tissue
leaf
Insert Size
1.5
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Image
KSUE18 DraI SO autoradiogram
KSUE18 HindIII SO autoradiogram
Data Source
Talbert, Luther E.95.07.06
ATMI92.09
Gill, Bikram S.92.09