Query (optional)   in Class  

GrainGenes Marker Report: XksuE19a

[ Printable Version ]  [ Submit comment/correction ]

Locus
XksuE19a
Type
RFLP
Chromosome
1D
Map
Wheat-Composite2004-1D5
[ Show Nearby Loci ]
Map Data
Wheat, Composite, 2004
Probe
pTtksuE19
Possible Orthologs
E019
[ Show all 12 ]



Probe for Locus
pTtksuE19
Locus
XksuE19
[ Show all 18 ]
Type
Genomic
STS
PCR primers
R:AGCCGGTTAGCTGTTCGTCT
L:TGTACCAGTGGGTCCCTAACGA
Polymorphism
KSUE19 EcoRI
KSUE19 HindIII
KSUE19 EcoRV
KSUE19 DraI
KSUE19 XbaI
Linkage Group
1D
Insert Enzyme
PstI
Source Species
Triticum aestivum
Triticum tauschii
Insert Size
1.3
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Image
KSUE19 BROWSSM autoradiogram
KSUE19 SO autoradiogram
Data Source
Talbert, Luther E.94.09.12
ATMI92.09
Gill, Bikram S.92.09