Query (optional)   in Class  

GrainGenes Marker Report: XksuE2-4B

[ Printable Version ]  [ Submit comment/correction ]

Locus
XksuE2-4B
Type
RFLP
Chromosome
4B
Chromosome Arm
4BL
Map
Ta-Courtot/CS-GPW-4B148.5
Ta-Synthetic/Opata-4B38.3
Ta-Synthetic/Opata-BARC-4B33.5
Ta-Synthetic/Opata-GPW-4B46
[ Show Nearby Loci ]
Map Data
Wheat, Courtot x Chinese Spring, GPW
Wheat, Synthetic x Opata  [ GBrowser ]
Wheat, Synthetic x Opata, BARC
Wheat, Synthetic x Opata, GPW
Probe
pTtksuE2
Image
KSUE2 SO autoradiogram
Possible Orthologs
E002
[ Show all 10 ]



Probe for Locus
pTtksuE2
Locus
XksuE2-4B
[ Show all 12 ]
Type
Genomic
STS
PCR primers
R:CTGATTTAGTCCTGTGGCAC
L:GTATTTCTACCATGGCTAGC
Specificity
Primer specificity verified, maps on chromosome 3BS.
Polymorphism
KSUE2 DraI
Linkage Group
3D
Insert Enzyme
PstI
Source Species
Triticum tauschii
Insert Size
1.5
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
Gill, Bikram S.
Image
KSUE2 SO autoradiogram
Data Source
Talbert, Luther E.94.09.12
ATMI92.09
Gill, Bikram S.92.09