Query (optional)   in Class  

GrainGenes Marker Report: XksuF1-5A

[ Printable Version ]  [ Submit comment/correction ]

Locus
XksuF1-5A
Type
RFLP
Chromosome
5A
Chromosome Arm
5AL
Map
5A, DS 5AEurope150.3
5A, DS 5AIran166.8
Tm-Dubcovsky2-5A88.7
[ Show Nearby Loci ]
Map Data
5A, DS 5AEurope
5A, DS 5AIran
T. monococcum, DV92 x G3116
Probe
pTtksuF1
Possible Orthologs
F001
[ Show all 6 ]



Probe for Locus
pTtksuF1
Locus
XksuF1-2A
[ Show all 8 ]
Reference
ReferenceGill KS et al. (1991) A genetic linkage map of Triticum tauschii (DD) and its relationship to the D genome of bread wheat (AABBDD). Genome 34:362-374.
Type
Genomic
STS
PCR primers
R:CAGTGGTTCACGATAGTAGAT
L:TTGGATAACTTCAGTCAGATG
Insert Enzyme
PstI
Source Species
Triticum aestivum
Triticum tauschii
Insert Size
1
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Data Source
Talbert, Luther E.94.09.12
ATMI92.09
Gill, Bikram S.92.09