Query (optional)   in Class  

GrainGenes Marker Report: XksuF36

[ Printable Version ]  [ Submit comment/correction ]

Locus
XksuF36
Chromosome
2D
Probe
pTtksuF36
Possible Orthologs
F036a
F036b



Probe for Locus
pTtksuF36
Locus
XksuF36-4A
[ Show all 6 ]
Type
Genomic
STS
PCR primers
R:GGCATGCACTACAGTGCATT
L:TGGTTCTCTACACGGCGAT
Linkage Group
2D (2)
Insert Enzyme
PstI
Source Species
Triticum aestivum
Triticum tauschii
Insert Size
0.8
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Data Source
Talbert, Luther E.94.09.12
ATMI92.09