Query (optional)   in Class  

GrainGenes Marker Report: XksuF37

[ Printable Version ]  [ Submit comment/correction ]

Locus
XksuF37
Type
RFLP
Chromosome
2B
6D
6R
Chromosome Arm
6DL
6RL
Map
Rye-2009-Consensus-6R70.9
Secale-PxP-update-6R77.4
Ta-Physical-Gill-6ABD95
Wheat-Composite2004-2B78
[ Show Nearby Loci ]
Breakpoint Interval
6L-0.89-1.00
Map Data
Rye, P87 x P105, update
Rye_2009_consensus
Wheat, Composite, 2004
Wheat, Physical
Species
Triticum aestivum
Probe
pTtksuF37
Reference
ReferenceBoyko EV et al. (1999) A high-density genetic linkage map of Aegilops tauschii, the D-genome progenitor of bread wheat. Theoretical and Applied Genetics 99:16-26.
Possible Orthologs
F037
ksuF37
XksuF37-6A
XksuF37-6B
XksuF37-6R



Probe for Locus
pTtksuF37
Locus
XksuF37-6A
[ Show all 9 ]
Type
Genomic
STS
PCR primers
R:CACAAAGACAAAGAACTAAT
L:TTCAGATTTTCACAGATTTA
Linkage Group
6D
Insert Enzyme
PstI
Source Species
Triticum aestivum
Triticum tauschii
Insert Size
0.9
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Data Source
Talbert, Luther E.94.09.12
ATMI92.09
Gill, Bikram S.92.09