Query (optional)   in Class  

GrainGenes Marker Report: XksuG48

[ Printable Version ]  [ Submit comment/correction ]

Locus
XksuG48
Type
RFLP
Chromosome
3D
6A
6D
Chromosome Arm
3DL
6DS
Map
Ta-Physical-Gill-3ABD82
[ Show all 6 ]
[ Show Nearby Loci ]
Breakpoint Interval
3DL-2/0
0/6DS-1
3L-0.63-1.00
6S-0.72-1.00
Map Data
T. monococcum, DV92 x G3116
Wheat, Composite, 2004
Wheat, Physical
Species
Triticum aestivum
Probe
pTtksuG48
Reference
ReferenceBoyko EV et al. (1999) A high-density genetic linkage map of Aegilops tauschii, the D-genome progenitor of bread wheat. Theoretical and Applied Genetics 99:16-26.
Possible Orthologs
G048a
[ Show all 13 ]



Probe for Locus
pTtksuG48
Locus
XksuG48-6B
[ Show all 14 ]
Synonym
Other nameDG G48
ReferenceMa Z-Q et al. (1993) RFLP markers linked to two Hessian fly-resistance genes in wheat (Triticum aestivum L.) from Triticum tauschii (coss.) Schmal. Theoretical and Applied Genetics 85:750-754.
Reference
ReferenceGill KS et al. (1991) A genetic linkage map of Triticum tauschii (DD) and its relationship to the D genome of bread wheat (AABBDD). Genome 34:362-374.
Type
Genomic
STS
PCR primers
R:CGGTAGGGCTCGTGCTCACC
L:AGGGAGGCTCGCTGGTTTTT
Polymorphism
KSUG48 EcoRV
Linkage Group
6D, 3D (2)
Insert Enzyme
PstI
Source Species
Triticum tauschii
Insert Size
1.6
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Image
KSUG48 SO autoradiogram
Data Source
Talbert, Luther E.94.09.12
ATMI92.09
Gill, Bikram S.92.09