Query (optional)   in Class  

GrainGenes Marker Report: XksuI27-1D.2

[ Printable Version ]  [ Submit comment/correction ]

Locus
XksuI27-1D.2
Type
RFLP
Chromosome
1D
Chromosome Arm
1DL
Map
Ta-Synthetic/Opata-1D147.9
Ta-Synthetic/Opata-BARC-1D151.1
Ta-Synthetic/Opata-gbx-1D151.7
Ta-Synthetic/Opata-GPW-1D179.1
Ta-Synthetic/Opata-SSR-1D191.1
[ Show Nearby Loci ]
Map Data
Wheat, Synthetic x Opata  [ GBrowser ]
Wheat, Synthetic x Opata, BARC
Wheat, Synthetic x Opata, gbx RFLP
Wheat, Synthetic x Opata, GPW
Wheat, Synthetic x Opata, SSR
Probe
pTtksuI27
Image
KSUI27 SO autoradiogram
Possible Orthologs
I027
[ Show all 12 ]



Probe for Locus
pTtksuI27
Locus
XksuI27-1
[ Show all 17 ]
Type
Genomic
STS
PCR primers
R:GCACTTCCATATCGAGGTTG
L:GTACCATTGCTCAACTACAG
Polymorphism
KSUI27 DraI
Insert Enzyme
PstI
Source Species
Triticum aestivum
Triticum tauschii
Insert Size
1.9
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Image
KSUI27 SO autoradiogram
Data Source
Talbert, Luther E.94.09.12
ATMI92.09
Gill, Bikram S.92.09