Query (optional)   in Class  

GrainGenes Marker Report: Xmag1132.1

[Submit comment/correction]

Locus
Xmag1132.1
Type
Microsatellite
Map
Ta-NxW-6B88.4
[ Show Nearby Loci ]
Map Data
Wheat, Nanda2419 x Wangshuibai
Probe
MAG1132
Possible Orthologs
Xmag1132.2



Probe for Locus
MAG1132
Locus
Xmag1132.1
Xmag1132.2
Reference
ReferenceXue S et al. (2008) A high-density intervarietal map of the wheat genome enriched with markers derived from expressed sequence tags. Theoretical and Applied Genetics 117:181-189.
Type
STS
PCR primers
Forward GTCATCTTCAGCCAGTCAACA
Reverse GCTTGCGGAGGGATAATG
Amplification Conditions
Anneal 50
Sequence
CN009420
Source Species
Triticum aestivum
Clone Location
Ma, Zhengqiang

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.