Query (optional)   in Class  

GrainGenes Marker Report: Xmwg2021-1A

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xmwg2021-1A
Type
RFLP
Map
T.b.xT.m.-1A60.3
Tm-Dubcovsky2-1A-54.9
[ Show Nearby Loci ]
Map Data
T. boeoticum x monococcum
T. monococcum, DV92 x G3116
Probe
MWG2021
Possible Orthologs
MWG2021a
[ Show all 9 ]



Probe for Locus
MWG2021
Locus
MWG2021a
[ Show all 10 ]
Type
Genomic
STS
STS primers
5' GTTCCACTGGATGCACCACA
5' CATCAAGCCTCACAACATCC
STS size
401
Amplification Conditions
STS annealing temperature 58-60 oC
Sequence
AJ234710
AJ234709
MWG2021-5
MWG2021-3
Insert Enzyme
PstI
Source Species
Hordeum vulgare
Clone Vector
Bluescript
Excision Enzyme
PstI
Clone Location
Graner, Andreas
Clone Authority
Graner, Andreas
Data Source
Graner, Andreas94.03.08
Kuenzel, Gottfried00.03