Query (optional)   in Class  

GrainGenes Marker Report: Xmwg539

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xmwg539
Type
RFLP
Chromosome
4R
Chromosome Arm
4RL
Map
Hordeum-IxT/Q-7H81.6
Rye-2009-Consensus-4R101.4
Secale-PxP-4120.5
Secale-PxP-update-4R117.7
[ Show Nearby Loci ]
Map Data
Barley, IxT/QTL
Rye, P87 x P105
Rye, P87 x P105, update
Rye_2009_consensus
Probe
MWG539
Possible Orthologs
MWG539
Xmwg539-4R



Probe for Locus
MWG539
Locus
MWG539
Xmwg539
Xmwg539-4R
Synonym
SynonymHAR35_18113
Type
Genomic
STS
STS primers
5' GCACTGCCCAATTCTTGC
5' CTTGATCTCCTTCGGGAGCG
STS size
ca. 900
Amplification Conditions
STS annealing temperature 55-58 oC
Sequence
AJ234494
AJ234493
MWG539-5
MWG539-3
Linkage Group
7H
Insert Enzyme
PstI
Source Species
Hordeum vulgare
Insert Size
1.2
Clone Vector
Bluescript
pBluescr.
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Graner, Andreas
Clone Authority
Graner, Andreas
Data Source
Graner, Andreas94.03.08
ATMI92.09
Kuenzel, Gottfried00.03