Query (optional)   in Class  

GrainGenes Marker Report: Xmwg813-3A

[Submit comment/correction]

Locus
Xmwg813-3A
Type
RFLP
Map
Tm-Dubcovsky2-3A-28.9
[ Show Nearby Loci ]
Map Data
T. monococcum, DV92 x G3116
Probe
MWG813
Possible Orthologs
MWG813
[ Show all 7 ]



Probe for Locus
MWG813
Locus
MWG813a
[ Show all 8 ]
Synonym
SynonymHAR35_15734
HAR35_2555
HAR35_2556
Reference
ReferenceGraner A et al. (1991) Construction of an RFLP map of barley Theoretical and Applied Genetics 83:250-256.
Type
Genomic
STS
STS primers
5' TTGGACAGGATGTTGCCA
5' CATTCAGTAACACCGCCATG
STS size
115
Amplification Conditions
STS annealing temperature 55-58 oC
Sequence
AJ234569
AJ234568
MWG813-5
MWG813-3
Insert Enzyme
PstI
Source Species
Hordeum vulgare
Clone Vector
Bluescript
Excision Enzyme
PstI
Clone Location
Graner, Andreas
Clone Authority
Graner, Andreas
Data Source
Graner, Andreas94.03.08
Kuenzel, Gottfried00.03

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.