Query (optional)   in Class  

GrainGenes Marker Report: Xmwg820-6A

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xmwg820-6A
Type
RFLP
Map
Tm-Dubcovsky2-6A-6.4
Tturgidum-Du-6A10.5
[ Show Nearby Loci ]
Map Data
T. monococcum, DV92 x G3116
T. turgidum, durum x dicoccoides
Probe
MWG820
Possible Orthologs
MWG820
[ Show all 8 ]



Probe for Locus
MWG820
Locus
MWG820
[ Show all 9 ]
Reference
ReferenceGraner A et al. (1991) Construction of an RFLP map of barley Theoretical and Applied Genetics 83:250-256.
Type
Genomic
STS
STS primers
5' GGGGAGAAAATGCATGCAAT
5' CAGCGTCGTATAAATGTCTT
STS size
265
Amplification Conditions
STS annealing temperature 55-58 oC
Sequence
AJ234573
AJ234572
MWG820-5
MWG820-3
Linkage Group
6H
Insert Enzyme
PstI
Source Species
Hordeum vulgare
Insert Size
1.5
Clone Vector
Bluescript
pBluescr.
Excision Enzyme
PstI
Clone Location
Graner, Andreas
Clone Authority
Graner, Andreas
Data Source
Graner, Andreas94.03.08
ATMI92.09
Kuenzel, Gottfried00.03