Query (optional)   in Class  

GrainGenes Marker Report: Xmwg844-4A

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xmwg844-4A
Type
RFLP
Map
Tm-Dubcovsky2-4A-23.8
[ Show Nearby Loci ]
Map Data
T. monococcum, DV92 x G3116
Probe
MWG844
Possible Orthologs
MWG844
[ Show all 7 ]



Probe for Locus
MWG844
Locus
MWG844a
[ Show all 8 ]
Synonym
SynonymHAR35_26589
HAR35_42594
HAR35_9645
Type
Genomic
STS
STS primers
5' TCAGGAACCTGGCACCAACG
5' CATCAGCCCGCGATACATCC
STS size
374
Amplification Conditions
STS annealing temperature 58-60 oC
Sequence
AJ234585
MWG844-5
Polymorphism
MWG844 EcoRI
Insert Enzyme
PstI
Source Species
Hordeum vulgare
Clone Vector
Bluescript
Excision Enzyme
PstI
Clone Location
Graner, Andreas
Clone Authority
Graner, Andreas
Image
MWG844 BROWS autoradiogram
Data Source
Graner, Andreas94.03.08
Kuenzel, Gottfried00.03