Query (optional)   in Class  

GrainGenes Marker Report: Xmwg913b

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xmwg913b
Type
RFLP
Chromosome
1R
Chromosome Arm
1RS
Map
Secale-PxP-146.5
Secale-PxP-update-1R63.5
[ Show Nearby Loci ]
Map Data
Rye, P87 x P105
Rye, P87 x P105, update
Probe
MWG913
Possible Orthologs
MWG913
Xmwg913a



Probe for Locus
MWG913
Locus
MWG913
Xmwg913a
Xmwg913b
Synonym
SynonymHAR35_16128
HAR35_1714
Type
Genomic
STS
STS primers
5' GCACCCTTGAAGCAGACATCG
5' GCCATGAGCGGGAATTTGC
STS size
370
Amplification Conditions
STS annealing temperature 55-58 oC
Sequence
AJ234643
MWG913
MWG913-5
Insert Enzyme
PstI
Source Species
Hordeum vulgare
Clone Vector
Bluescript
Excision Enzyme
PstI
Clone Location
Graner, Andreas
Clone Authority
Graner, Andreas
Data Source
Graner, Andreas94.03.08
Kuenzel, Gottfried00.03