Query (optional)   in Class  

GrainGenes Marker Report: Xwmc607-7A

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xwmc607-7A
Type
Microsatellite
Chromosome
7A
Map
Ta-SSR-2004-7A77
[ Show Nearby Loci ]
Map Data
Wheat, Consensus SSR, 2004
Probe
WMC607
Reference
ReferenceSomers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114.
Possible Orthologs
Xwmc607
wmc607
wmc607-7A



Probe for Locus
WMC607
Locus
Xwmc607
Xwmc607-7A
wmc607
wmc607-7A
Reference
ReferenceSomers DJ and Isaac P (2004) SSRs from the Wheat Microsatellite Consortium.
General Remarks
Wheat Microsatellite Consortium Project 2
Donor: Somers, Agriculture Canada
Type
PCR
SSR
PCR primers
Forward ATATATGCCCATGAAGCTCAAG
Reverse GATCGAGCTAAAGCTGATACCA
SSR size
145 bases expected, Chinese Spring
Amplification Conditions
61C anneal.
Source Species
Triticum aestivum
Data Source
Somers, Daryl J.2004.10
Somers, Daryl J.2006.07