Query (optional)   in Class  

GrainGenes Marker Report: Xwmc617-4B

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xwmc617-4B
Type
Microsatellite
Chromosome
4B
Chromosome Arm
4BS
Map
Kofa/UC1113-4B0
Ta-SSR-2004-4B0
Triticum-WxM-FHB-QTL-4B0
[ Show Nearby Loci ]
Map Data
Durum wheat, Kofa x UC1113
Durum wheat, Svevo x Ciccio
Wheat, Consensus SSR, 2004
Wheat, WxM, FHB QTL
Probe
WMC617
Reference
ReferenceSomers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114.
ReferenceSomers DJ et al. (2003) Molecular mapping of novel genes controlling Fusarium head blight resistance and deoxynivalenol accumulation in spring wheat Genome 46:555-564.
Possible Orthologs
Xwmc617
[ Show all 11 ]



Probe for Locus
WMC617
Locus
Xwmc617-4A
[ Show all 12 ]
Reference
ReferenceSomers DJ and Isaac P (2004) SSRs from the Wheat Microsatellite Consortium.
General Remarks
Wheat Microsatellite Consortium Project 2
Donor: Somers, Agriculture Canada
Type
PCR
SSR
PCR primers
Forward CCACTAGGAAGAAGGGGAAACT
Reverse ATCTGGATTACTGGCCAACTGT
SSR size
247 bases expected, Chinese Spring
Amplification Conditions
61C anneal.
Source Species
Triticum aestivum
Data Source
Somers, Daryl J.2004.10
Somers, Daryl J.2006.07