Query (optional)   in Class  

GrainGenes Marker Report: Xwmc657-4B

[Submit comment/correction]

Locus
Xwmc657-4B
Type
Microsatellite
Chromosome
4B
Map
Kofa/UC1113-4B56
Ta-SSR-2004-4B26.7
[ Show Nearby Loci ]
QTL with Locus Marker
QSn.sdau-4BL
Map Data
Durum wheat, Kofa x UC1113
Wheat, Consensus SSR, 2004
Probe
WMC657
Reference
ReferenceSomers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114.
Possible Orthologs
wmc657



Probe for Locus
WMC657
Locus
Xwmc657-4B
wmc657
Reference
ReferenceSomers DJ and Isaac P (2004) SSRs from the Wheat Microsatellite Consortium.
General Remarks
Wheat Microsatellite Consortium Project 2
Donor: Somers, Agriculture Canada
Type
PCR
SSR
PCR primers
Forward CGGGCTGCGGGGGTAT
Reverse CGGTTGGGTCATTTGTCTCA
SSR size
119 bases expected, Chinese Spring
Amplification Conditions
61C anneal.
Source Species
Triticum aestivum
Data Source
Somers, Daryl J.2004.10
Somers, Daryl J.2006.07

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.