Query (optional)   in Class  

GrainGenes Marker Report: Xwmc664

[Submit comment/correction]

Locus
Xwmc664
Type
Microsatellite
Map
Ta-NxW-3A75
[ Show Nearby Loci ]
Map Data
Wheat, Nanda2419 x Wangshuibai
Probe
WMC664
Possible Orthologs
Xwmc664-3A
[ Show all 11 ]



Probe for Locus
WMC664
Locus
Xwmc664-3A
[ Show all 12 ]
Reference
ReferenceSomers DJ and Isaac P (2004) SSRs from the Wheat Microsatellite Consortium.
General Remarks
Wheat Microsatellite Consortium Project 2
Donor: Somers, Agriculture Canada
Type
PCR
SSR
PCR primers
Forward GGGCCAACAAATCCAAT
Reverse TCTACTTCCTTCATCCACTCC
SSR size
157 bases expected, Chinese Spring
Amplification Conditions
61C anneal.
Source Species
Triticum aestivum
Data Source
Somers, Daryl J.2004.10
Somers, Daryl J.2006.07

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.