Query (optional)   in Class  

GrainGenes Marker Report: cMWG652a

[ Printable Version ]  [ Submit comment/correction ]

Locus
cMWG652a
Type
RFLP
SNP
Synonym
SynonymcMWG652
Chromosome
6H
Map
Barley-Consensus2-6H26.5
[ Show all 18 ]
[ Show Nearby Loci ]
QTL with Locus Marker
QTw.HaMo-6H.1
Map Data
Barley consensus 2
[ Show all 18 ]
Species
Hordeum vulgare
Probe
cMWG652
Reference
ReferenceClose TJ et al. (2009) Development and implementation of high-throughput SNP genotyping in barley. BMC Genomics 10:582.
[ Show all 6 ]
Data Source
Blake, Tom05.04.19
Close, Timothy J.
Remark
Number of populations contributing to the placement of cMWG652A in the Barley, Consensus 2006 DArT maps = 1
Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb'
Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex,Oregon Wolfe Barleys,Igri x Franka
Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex; Igri x Franka
Locus in 'Barley, Consensus 2007, SSR' was a BIN marker in 'Barley, Consensus 2006, Marcel'
Possible Orthologs
cMWG652
[ Show all 14 ]



Probe for Locus
cMWG652
Locus
Xcmwg652-6
[ Show all 19 ]
Reference
ReferenceAbu Qamar M et al. (2008) A region of barley chromosome 6H harbors multiple major genes associated with net type net blotch resistance. Theoretical and Applied Genetics 117:1261-1270.
ReferenceKunzel G et al. (2000) Cytologically integrated physical restriction fragment length polymorphism maps for the barley genome based on translocation breakpoints Genetics 154:397-412.
ReferenceGraner A et al. (1991) Construction of an RFLP map of barley Theoretical and Applied Genetics 83:250-256.
General Remarks
Restriction enzyme informative in CAP analysis is HaeIII
Type
cDNA
STS
STS primers
5' GAGCTGCTCGTTCTCGTTGA
5' CACACCTTCTTCTTCCTCTT
STS size
417
Amplification Conditions
STS annealing temperature 55-58 oC
Sequence
AJ234405
AJ234404
CMWG652-5
CMWG652-3
Linkage Group
6H
6
DNA Library
cMWG
Source Species
Hordeum vulgare
Source Tissue
Leaf
Insert Size
1
Clone Vector
Bluescript
pBluescr.
pBS
Excision Enzyme
EcoRI
Clone Location
GrainGenes Probe Repository
Graner, Andreas
Clone Authority
Graner, Andreas
Data Source
Graner, Andreas94.03.08
ATMI92.09
Stein, Nils2006.10
Kleinhofs, Andris96.05.08
Kuenzel, Gottfried00.03