Query (optional)   in Class  

GrainGenes Marker Report: cMWG663A

[ Printable Version ]  [ Submit comment/correction ]

Locus
cMWG663A
Type
RFLP
Synonym
SynonymcMWG663
Chromosome
2H
Map
Hordeum-Bins-2H165.8
[ Show all 6 ]
[ Show Nearby Loci ]
Map Data
Barley, Abiotic QTL Consensus
[ Show all 6 ]
Probe
cMWG663
Reference
ReferenceRostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
ReferenceMesfin A et al. (2003) Quantitative trait loci for fusarium head blight resistance in barley detected in a two-rowed by six-rowed population Crop Science 43:307-318.
Possible Orthologs
cMWG663
cMWG663-2H
cMWG663B
Xcmwg663-2



Probe for Locus
cMWG663
Locus
Xcmwg663-2
cMWG663
cMWG663A
cMWG663B
cMWG663-2H
Synonym
SynonymHAR35_10087
HAR35_16744
HAR35_41390
Reference
ReferenceGraner A et al. (1991) Construction of an RFLP map of barley Theoretical and Applied Genetics 83:250-256.
Type
cDNA
STS
STS primers
5' GAGGATGACAACGTCTCAGC
5' AAGCACCAGAATTAGCCTGG
STS size
451
Amplification Conditions
STS annealing temperature 55-58 oC
Sequence
AJ234411
AJ234410
CMWG663-5
CMWG663-3
DNA Library
cMWG
Source Species
Hordeum vulgare
Source Tissue
Leaf
Clone Vector
Bluescript
Clone Location
GrainGenes Probe Repository
Graner, Andreas
Clone Authority
Graner, Andreas
Data Source
Graner, Andreas94.03.08
Stein, Nils2006.10
Kuenzel, Gottfried00.03