Query (optional)   in Class  

GrainGenes Marker Report: cMWG682

[Submit comment/correction]

Locus
cMWG682
Type
RFLP
STS
Synonym
SynonymcMWG682
Chromosome
2H
Chromosome Arm
2HS
Map
Barley-Consensus-2H-66.5
[ Show all 15 ]
[ Show Nearby Loci ]
Map Data
Barley consensus
[ Show all 15 ]
Species
Hordeum vulgare
Hordeum vulgare subsp. spontaneum
Probe
cMWG682
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
ReferenceRostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Data Source
Blake, Tom05.04.19
Remark
Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb'
Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex,Igri x Franka
Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex; Igri x Franka
Possible Orthologs
cMWG682-2H
[ Show all 9 ]



Probe
cMWG682
Locus
cMWG682
[ Show all 11 ]
Synonym
SynonymHAR35_1246
HAR35_1247
HAR35_34385
Reference
ReferenceSayed-Tabatabaei BE et al. (1998) DNA sequencing and primer designing for RFLP clones evenly distributed in the barley genome. Barley Genetics Newsletter 28:15-18.
ReferenceGraner A et al. (1991) Construction of an RFLP map of barley Theoretical and Applied Genetics 83:250-256.
Type
cDNA
STS
STS primers
T7 side (5' to 3') GCTCACTGCTTCGGAAAACAACGAC
T3 side (5' to 3') ATAGCACCTCCAAAATAAGAGCCTT
Sequence
AJ234421
cMWG682
CMWG682-5
Linkage Group
2
DNA Library
cMWG
Source Species
Hordeum vulgare
Source Tissue
Leaf
Insert Size
0.8
Clone Vector
Bluescript
pBS
Excision Enzyme
EcoRI
Clone Location
GrainGenes Probe Repository
Graner, Andreas
Clone Authority
Graner, Andreas
Data Source
Graner, Andreas94.03.08
Stein, Nils2006.10
Kleinhofs, Andris96.05.08



Locus for Probe
cMWG682-2H
Type
RFLP
Map
Hv-Consensus2006-Stein-2H2.3
Hv-IxF-Stein-2H0
Hv-SxM-Stein-2H0
[ Show Nearby Loci ]
Map Data
Barley, Consensus 2006, Stein
Barley, IxF, Stein2006
Barley, SxM, Stein2006
Probe
cMWG682
Possible Orthologs
cMWG682
[ Show all 9 ]



Locus for Probe
Xcmwg682
Type
RFLP
Chromosome
7R
Chromosome Arm
7RL
Map
Rye-2009-Consensus-7R38.9
Secale-PxP-update-7R153.9
[ Show Nearby Loci ]
Map Data
Rye, P87 x P105, update
Rye_2009_consensus
Probe
cMWG682
Possible Orthologs
cMWG682
[ Show all 9 ]



Locus for Probe
Xcmwg682 b
Type
RFLP
Chromosome
2D
Map
Wheat-Composite2004-2D47
[ Show Nearby Loci ]
Map Data
Wheat, Composite, 2004
Probe
cMWG682
Possible Orthologs
cMWG682
[ Show all 9 ]



Locus for Probe
Xcmwg682-2
Type
RFLP
Chromosome Arm
2S
Map
Triticeae-Sorrells-217.2
[ Show Nearby Loci ]
Map Data
Triticeae consensus
Probe
cMWG682
Possible Orthologs
cMWG682
[ Show all 9 ]



Locus for Probe
Xcmwg682-2A
Type
RFLP
Chromosome
2A
Chromosome Arm
2A
Map
Ta-Synthetic/Opata-2A6.8
Ta-Synthetic/Opata-BARC-2A3
[ Show Nearby Loci ]
Map Data
Wheat, Synthetic x Opata  [ GBrowser ]
Wheat, Synthetic x Opata, BARC
Probe
cMWG682
Possible Orthologs
cMWG682
[ Show all 9 ]



Locus for Probe
Xcmwg682-2B
Type
RFLP
Map
Ta-Synthetic/Opata-GPW-2B-47.5
[ Show Nearby Loci ]
Map Data
Wheat, Synthetic x Opata, GPW
Probe
cMWG682
Possible Orthologs
cMWG682
[ Show all 9 ]



Locus for Probe
Xcmwg682-2D
Type
RFLP
Chromosome
2D
Chromosome Arm
2DS
Map
Ta-Synthetic/Opata-2D15.9
[ Show all 8 ]
[ Show Nearby Loci ]
Map Data
Wheat, Synthetic x Opata  [ GBrowser ]
[ Show all 8 ]
Probe
cMWG682
Possible Orthologs
cMWG682
[ Show all 9 ]



Locus for Probe
Xcmwg682a
Type
RFLP
Chromosome
2A
2B
2D
Map
Wheat-Composite2004-2A2
Wheat-Composite2004-2B3
Wheat-Composite2004-2D12
[ Show Nearby Loci ]
Map Data
Wheat, Composite, 2004
Probe
cMWG682
Possible Orthologs
cMWG682
[ Show all 9 ]



Locus for Probe
Xcmwg682b
Type
RFLP
Chromosome
2A
Map
Wheat-Composite2004-2A71
[ Show Nearby Loci ]
Map Data
Wheat, Composite, 2004
Probe
cMWG682
Possible Orthologs
cMWG682
[ Show all 9 ]



Locus for Probe
Yr17/Lr37/Sr38
Type
Trait
Chromosome
2A
Chromosome Arm
2A
Map
Wheat-Composite2004-2A0
[ Show Nearby Loci ]
Species
Triticum aestivum
Probe
cMWG682
Associated Gene
Lr37 (Triticum)
Sr38 (Triticum)
Yr17 (Triticum)
Gene Class
Reaction to Puccinia graminis Pers.
Reaction to Puccinia recondita Rob. ex Desm.
Reaction to Puccinia striiformis Westend.
Data Source
Soria, Marcelo A.
Remark
Trait marker Xcmwg682-2A
Nearby marker on Composite map: Xcmwg682a
Position on Composite map estimated by GrainGenes.

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.