Query (optional)   in Class  

GrainGenes Marker Report: ksuA1

[ Printable Version ]  [ Submit comment/correction ]

Locus
ksuA1
Type
RFLP
Chromosome
5H
Map
Hordeum-Consensus2006-DArT-5H86.3
Hordeum-CxS-5H96.64
Hordeum-GxH-5H107.56
Oat-KxO/2003-19+2720
Wheat, Yr genes and QTL 5B39.3
[ Show Nearby Loci ]
QTL with Locus Marker
QSr.CaBo-5H
Map Data
Barley, Consensus 2006, DArT
Barley, CxS
Barley, GxH
Oat, KxO, 2003
Wheat, Yr genes and QTL
Probe
pTtksuA1
Reference
ReferenceWenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206.
Remark
Number of populations contributing to the placement of ksuA1 in the Barley, Consensus 2006 DArT maps = 1
Marker placement value = 3.44 cM on map Oat-KxO/2003-19+27
Marker is not a framework marker on map Oat-KxO/2003-19+27
Possible Orthologs
A001
[ Show all 24 ]



Probe for Locus
pTtksuA1
Locus
Xksu-A1
[ Show all 26 ]
Reference
ReferenceGill KS et al. (1991) A genetic linkage map of Triticum tauschii (DD) and its relationship to the D genome of bread wheat (AABBDD). Genome 34:362-374.
Type
Genomic
STS
PCR primers
R:AAGATTGTCAACAAGTGCC
L:CAACAGAGATATTGCCGTAG
Polymorphism
KSUA1 DraI
KSUA1 XbaI
KSUA1 EcoRI
KSUA1 EcoRV
KSUA1 HindIII
Linkage Group
7D / 7DS
Barley 1 (7H)
Insert Enzyme
PstI
Source Species
Triticum tauschii
Insert Size
1.2
Clone Vector
pUC18
pUC
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Clone Authority
Gill, Bikram S.
Image
KSUA1 KO autoradiogram
KSUA1 SO autoradiogram
Data Source
Talbert, Luther E.94.09.12
ATMI92.09
Kleinhofs, Andris96.05.08
Gill, Bikram S.92.09



Probe
ksuA1