Query (optional)   in Class  

GrainGenes Marker Report: ksuA3(A)

[ Printable Version ]  [ Submit comment/correction ]

Locus
ksuA3(A)
Type
RFLP
Map
Hordeum-CxH-5H47.05
Hordeum-CxS-5H4.96
Hordeum-GxH-2H42.7
[ Show Nearby Loci ]
Map Data
Barley, CxH
Barley, CxS
Barley, GxH
Probe
pTtksuA3



Probe for Locus
pTtksuA3
Locus
DGA3
[ Show all 17 ]
Type
Genomic
STS
PCR primers
R:GTATTATGGTCCATGTCTAC
L:AACATGGTCCTCAGGGAATC
Specificity
Primer specificity verified, maps on chromosome 5D.
Linkage Group
5D
Insert Enzyme
PstI
Source Species
Triticum aestivum
Triticum tauschii
Insert Size
1.4
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Data Source
Talbert, Luther E.94.09.12
ATMI92.09
Gill, Bikram S.92.09