Query (optional)   in Class  

GrainGenes Marker Report: ksuA3B

[ Printable Version ]  [ Submit comment/correction ]

Locus
ksuA3B
Type
RFLP
Synonym
SynonympTtksuA3
Chromosome
6H
Map
Barley-Consensus2-6H60.7
[ Show all 11 ]
[ Show Nearby Loci ]
Map Data
Barley consensus 2
[ Show all 11 ]
Probe
pTtksuA3
Reference
ReferenceWenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206.
ReferenceRostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Data Source
Blake, Tom05.04.19
Remark
Number of populations contributing to the placement of ksuA3b in the Barley, Consensus 2006 DArT maps = 1
Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb'
Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex
Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex
Possible Orthologs
A003
[ Show all 6 ]



Probe for Locus
pTtksuA3
Locus
DGA3
[ Show all 17 ]
Type
Genomic
STS
PCR primers
R:GTATTATGGTCCATGTCTAC
L:AACATGGTCCTCAGGGAATC
Specificity
Primer specificity verified, maps on chromosome 5D.
Linkage Group
5D
Insert Enzyme
PstI
Source Species
Triticum aestivum
Triticum tauschii
Insert Size
1.4
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Data Source
Talbert, Luther E.94.09.12
ATMI92.09
Gill, Bikram S.92.09