Query (optional)   in Class  

GrainGenes Marker Report: pTtksuG12

[ Printable Version ]  [ Submit comment/correction ]

Probe
pTtksuG12
Locus
XksuG12-4A
[ Show all 17 ]
Type
Genomic
STS
PCR primers
R:TATACTTCTGAGCTGCCGAG
L:CCAGTGTTGTAGTTCTCTAT
Polymorphism
KSUG12 EcoRI
KSUG12 EcoRV
KSUG12 DraI
KSUG12 HindIII
KSUG12 XbaI
Insert Enzyme
PstI
Source Species
Triticum aestivum
Triticum tauschii
Clone Vector
pUC18
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Image
KSUG12 SO autoradiogram
Data Source
Talbert, Luther E.94.09.12
Gill, Bikram S.92.09



Locus for Probe
ksuG12-7A
Type
RFLP
Chromosome
7A
Probe
pTtksuG12
Possible Orthologs
G012a
[ Show all 12 ]



Locus for Probe
D1.1_ctg3510
Type
BAC_contig
Map
Ta-Physical-Gill-5D3.51
[ Show Nearby Loci ]
Probe
pTtksuG12



Locus for Probe
D1.1_ctg4478
Type
BAC_contig
Map
Chinese_Spring_Deletion_3D0.54
Ta-Physical-Gill-5D3.51
[ Show Nearby Loci ]
Probe
BF482732
pTtksuG12



Locus for Probe
G012a
Type
RFLP
Map
Tt-Gill-5D338.4
[ Show Nearby Loci ]
Map Data
T.tauschii
Probe
pTtksuG12
Possible Orthologs
G012b
[ Show all 12 ]



Locus for Probe
G012b
Type
RFLP
Map
Tt-Gill-7D326.5
[ Show Nearby Loci ]
Map Data
T.tauschii
Probe
pTtksuG12
Possible Orthologs
G012a
[ Show all 12 ]



Locus for Probe
HD012C22
Probe
pTtksuG12



Locus for Probe
HD014C5
Probe
BF482732
pTtksuG12



Locus for Probe
ksuG12
Type
RFLP
Map
Wheat, Yr genes and QTL 7A44.1
[ Show Nearby Loci ]
Map Data
Wheat, Yr genes and QTL
Probe
pTtksuG12
Possible Orthologs
G012a
[ Show all 12 ]



Locus for Probe
XksuG12
Type
RFLP
Chromosome
5D
7B
7D
Map
Ta-Physical-Gill-5D3.51
Wheat-Composite2004-7B52
[ Show Nearby Loci ]
Breakpoint Interval
5DL-12/5DL-1
Map Data
Wheat, Composite, 2004
Wheat, Physical
Probe
pTtksuG12
Possible Orthologs
G012a
[ Show all 12 ]



Locus for Probe
XksuG12-4A
Type
RFLP
Chromosome
4A
Chromosome Arm
4AL
Map
Ta-Synthetic/Opata-4A36.3
Ta-Synthetic/Opata-BARC-4A36.2
Ta-Synthetic/Opata-DR-4A15.7
Ta-Synthetic/Opata-GPW-4A38.6
Ta-Synthetic/Opata-SSR2-4A46.1
[ Show Nearby Loci ]
Map Data
Wheat, Synthetic x Opata  [ GBrowser ]
Wheat, Synthetic x Opata, BARC
Wheat, Synthetic x Opata, DR Genes
Wheat, Synthetic x Opata, GPW
Wheat, Synthetic x Opata, SSR 2
Probe
pTtksuG12
Possible Orthologs
G012a
[ Show all 12 ]



Locus for Probe
XksuG12-5B
Type
RFLP
Chromosome
5B
Map
Ta-Synthetic/Opata-GPW-5B31
[ Show Nearby Loci ]
Map Data
Wheat, Synthetic x Opata, GPW
Probe
pTtksuG12
Possible Orthologs
G012a
[ Show all 12 ]



Locus for Probe
XksuG12-6B
Type
RFLP
Chromosome
6B
Map
Ta-Courtot/CS-GPW-6B92.9
[ Show Nearby Loci ]
Map Data
Wheat, Courtot x Chinese Spring, GPW
Probe
pTtksuG12
Possible Orthologs
G012a
[ Show all 12 ]



Locus for Probe
XksuG12-7A
Type
RFLP
Chromosome
7A
Chromosome Arm
7AL
Map
Ta-Courtot/CS-GPW-7A178.2
[ Show all 7 ]
[ Show Nearby Loci ]
Map Data
Wheat, Courtot x Chinese Spring, GPW
[ Show all 7 ]
Probe
pTtksuG12
Possible Orthologs
G012a
[ Show all 12 ]



Locus for Probe
XksuG12-7B
Type
RFLP
Chromosome
7B
Map
Ta-Synthetic/Opata-GPW-7B27.2
[ Show Nearby Loci ]
Map Data
Wheat, Synthetic x Opata, GPW
Probe
pTtksuG12
Possible Orthologs
G012a
[ Show all 12 ]



Locus for Probe
XksuG12a
Type
RFLP
Chromosome
6B
7A
Map
Wheat-Composite2004-6B152
Wheat-Composite2004-7A60
[ Show Nearby Loci ]
Map Data
Wheat, Composite, 2004
Probe
pTtksuG12
Possible Orthologs
G012a
[ Show all 12 ]



Locus for Probe
XksuG12b
Type
RFLP
Chromosome
4A
7A
Map
Wheat-Composite2004-4A78
Wheat-Composite2004-7A97
[ Show Nearby Loci ]
Map Data
Wheat, Composite, 2004
Probe
pTtksuG12
Possible Orthologs
G012a
[ Show all 12 ]



Locus for Probe
XksuG12c
Type
RFLP
Chromosome
7A
Map
Wheat-Composite2004-7A137
[ Show Nearby Loci ]
Map Data
Wheat, Composite, 2004
Probe
pTtksuG12
Possible Orthologs
G012a
[ Show all 12 ]