Query (optional)   in Class  

GrainGenes Marker Report: scsnp02972

[ Printable Version ]  [ Submit comment/correction ]

Locus
scsnp02972
Type
SNP
Synonym
Other nameSNP490
SynonymABC02972_L01R01
Chromosome
2H
Map
Hordeum-Consensus2005-SNP-2H114.184
Hordeum-OWB-SNP-2H125.25
Hordeum-QTLConsensus-Abiotic-2H114.18
Hordeum-QTLConsensus-Agronomic-2H114.18
[ Show Nearby Loci ]
Map Data
Barley, Abiotic QTL Consensus
Barley, Agronomic QTL Consensus
Barley, Consensus 2005, SNP
Barley, OWB, SNP
Probe
ABC02972_L01R01
Reference
ReferenceRostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Data Source
Russell, Joanne



Probe for Locus
ABC02972_L01R01
Locus
scsnp02972
Data at Germinate
ABC02972
Data at PLEXdb
Barley1_02972
General Remarks
Estimated product size = 191
BarleySNP type = SNP From EST
Technology platform used = PyrosequencingTM Technology
Affymetrix contig name = abc02972
Type
STS
PCR primers
5' GAGAGACCGAGCGAGGAAAT
5' CTTCTTGGTGGTGTCGATCTC
Sequence
Barley1_02972
Source Species
Hordeum vulgare
Data Source
Russell, Joanne