Query (optional)   in Class  

GrainGenes Marker Report: scssr03381

[ Printable Version ]  [ Submit comment/correction ]

Locus
scssr03381
Type
Microsatellite
SNP
Synonym
Other nameCtig1624
SynonymABC03381_L01R01
Chromosome
2H
Map
Barley, B73xCPI-2H64.9
[ Show all 9 ]
[ Show Nearby Loci ]
Map Data
Barley, Abiotic QTL Consensus
[ Show all 9 ]
Species
Hordeum vulgare
Probe
ABC03381_L01R01
scssr03381
Reference
ReferenceSzucs P et al. (2009) An Integrated Resource for Barley Linkage Map and Malting Quality QTL Alignment The Plant Genome 2:134-140.
ReferenceVarshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091.
ReferenceRostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
ReferenceRamsay L et al. (2004) Variation shown by molecular markers in barley: genomic and genetic contraints Aspects of Applied Biology 72:146-154.
Data Source
Russell, Joanne
Remark
Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb'
Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Oregon Wolfe Barleys
Locus in 'Barley, Consensus 2007, SSR' mapped in population(s) : OWBrecessive x OWBdominant
Insert contains repeat (GT)7
Developing laboratory = SCRI (R. Waugh)



Probe for Locus
ABC03381_L01R01
Locus
scssr03381
Data at Germinate
ABC03381
Data at PLEXdb
Barley1_03381
General Remarks
Estimated product size = 162
BarleySNP type = Contig Indel
Technology platform used = Radioisotope Labelled PCR Separation
Affymetrix contig name = abc03381
PCR primers
5' CAGGGACGTACAATATTACCG
5' AATAAGCAGGGTACCTTTTGG
Sequence
Barley1_03381
Source Species
Hordeum vulgare
Data Source
Russell, Joanne



Probe
scssr03381
Locus
scssr03381
Reference
ReferenceVarshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091.
ReferenceHearnden PR et al. (2007) A genetic map of 1,000 SSR and DArT markers in a wide barley cross. Theoretical and Applied Genetics 115:383-391.
ReferenceRamsay L et al. (2004) Variation shown by molecular markers in barley: genomic and genetic contraints Aspects of Applied Biology 72:146-154.
Type
SSR
EST
PCR primers
CAGGGACGTACAATATTACCG
AATAAGCAGGGTACCTTTTGG