Query (optional)   in Class  

GrainGenes Marker Report: scssr09041

[ Printable Version ]  [ Submit comment/correction ]

Locus
scssr09041
Type
Microsatellite
SNP
Synonym
Other nameCtig7646
SynonymABC09041_L01R01
Chromosome
5H
Map
Barley, B73xCPI-5H172.4
[ Show all 9 ]
[ Show Nearby Loci ]
Map Data
Barley, Abiotic QTL Consensus
[ Show all 9 ]
Species
Hordeum vulgare
Probe
ABC09041_L01R01
ABC9041
scssr09041
Reference
ReferenceVarshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091.
ReferenceRostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
ReferenceRamsay L et al. (2004) Variation shown by molecular markers in barley: genomic and genetic contraints Aspects of Applied Biology 72:146-154.
Data Source
Russell, Joanne
Remark
Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb'
[ Show all 6 ]



Probe for Locus
ABC9041
Locus
scssr09041



Probe for Locus
ABC09041_L01R01
Locus
scssr09041
Data at Germinate
ABC09041
Data at PLEXdb
Barley1_09041
General Remarks
Estimated product size = 164
BarleySNP type = Contig Indel
Technology platform used = Radioisotope Labelled PCR Separation
Affymetrix contig name = abc09041
PCR primers
5' CATGTCAGTGGGGTTCTAGC
5' TCTACTTGGACCTGCTGACC
Sequence
Barley1_09041
Source Species
Hordeum vulgare
Data Source
Russell, Joanne



Probe
scssr09041
Locus
scssr09041
Reference
ReferenceHearnden PR et al. (2007) A genetic map of 1,000 SSR and DArT markers in a wide barley cross. Theoretical and Applied Genetics 115:383-391.
ReferenceVarshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091.
ReferenceRamsay L et al. (2004) Variation shown by molecular markers in barley: genomic and genetic contraints Aspects of Applied Biology 72:146-154.
Type
SSR
EST
PCR primers
CATGTCAGTGGGGTTCTAGC
TCTACTTGGACCTGCTGACC