Query (optional)   in Class  

GrainGenes Marker Report: ABC322B

Locus
ABC322B
Type
RFLP
Synonym
SynonymABC322
Chromosome
1H
Map
Barley-Consensus2-1H137.7
[ Show all 15 ]
[ Show Nearby Loci ]
QTL with Locus Marker
QABA.StMo-1H
Map Data
Barley consensus 2
[ Show all 15 ]
Probe
ABC322
Reference
ReferenceRodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184.
ReferenceWenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206.
ReferenceRostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
ReferenceLi JZ et al. (2003) Development and genetic mapping of 127 new microsatellite markers in barley Theoretical and Applied Genetics 107:1021-1027.
Data Source
Blake, Tom05.04.19
Remark
Number of populations contributing to the placement of ABC322B in the Barley, Consensus 2006 DArT maps = 1
Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb'
Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex
Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex
Possible Orthologs
ABC322A



Probe for Locus
ABC322
Locus
ABC322B
HD084P24
ABC322A
Synonym
SynonymHAR35_8900
External Databases
DDBJ
EMBL
GenBank
Type
STS
PCR primers
ACATTGTTCAGTGCTGATTC
ATCAGGCTGGTATCTGTTTC
Sequence
L43950
ABC322
Polymorphism
ABC322 EcoRI
Source Species
Hordeum vulgare
Clone Location
GrainGenes Probe Repository
Clone Authority
Blake, Tom
Image
ABC322 BROWSSM autoradiogram
Data Source
Blake, Tom95.08.24