Query (optional)   in Class  

GrainGenes Marker Report: BAGY2CM61m

[ Printable Version ]  [ Submit comment/correction ]

Locus
BAGY2CM61m
Type
SSAP
Chromosome
3H
Map
Hordeum-SxM-SSAP-3H108
[ Show Nearby Loci ]
Map Data
Barley, Steptoe x Morex, SSAP
Probe
BAGY2CM61
Reference
ReferenceRodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184.



Probe for Locus
BAGY2CM61
Locus
[ Hide all but 1 of 23 ]
BAGY2CM61h
BAGY2CM61n
BAGY2CM61q
BAGY2CM61b
BAGY2CM61o
BAGY2CM61l
BAGY2CM61w
BAGY2CM61t
BAGY2CM61j
BAGY2CM61k
BAGY2CM61a
BAGY2CM61m
BAGY2CM61f
BAGY2CM61e
BAGY2CM61c
BAGY2CM61u
BAGY2CM61r
BAGY2CM61i
BAGY2CM61s
BAGY2CM61v
BAGY2CM61g
BAGY2CM61d
BAGY2CM61p
Reference
ReferenceLeigh F et al. (2003) Comparison of the utility of barley retrotransposon families for genetic analysis by molecular marker techniques Molecular Genetics and Genomics 269:464-474.
General Remarks
Position of retroposon-based primer in the LTR = 5' and 35 nucleotides internal to the LTR terminus
MseI primer (KeyGene code) = CTG (M61)
Type
PCR
STS
PCR primers
BAGY-2-C0589 5' TTCGACACTCTTACTTATCGAAAGG 3'
Mse1 primer M61 5' GATGAGTCCTGAGTAACTG 3'
Amplification Conditions
amplified as Vos et al Nucl Acids Res 23: 4407-4416
Source Species
Hordeum vulgare