Query (optional)   in Class  

GrainGenes Marker Report: BARC121

[ Submit comment/correction ]

Probe
BARC121
Locus
[ Hide all but 1 of 14 ]
Xbarc121-7A
Xbarc121-7D
Xbarc121.2
XbarcM121-6D
barc121-7A
Sr22
barc121
barc121_1
barc121_2
Xbarc121
barc121-7A.1
barc121-7D.1
barc121-7A.2
barc121-7D.2
Remarks
Contains motif : (CT)17
BARC primer pairs are developed by P. Cregan, Q. Song and associates at the USDA-ARS Beltsville Agriculture Research Station. Meiotic map information was developed by J.R. Shi, R. Ward and associates at Michigan State University. Deletion map information was developed by B.Gill, S. Singh and associates at Kansas State University. Funding for this research is provided by USDA-ARS in conjunction with the U.S. Wheat and Barley Scab Initiative.
Type
PCR
SSR
PCR primers
5' ACTGATCAGCAATGTCAACTGAA 3'
5' CCGGTGTCTTTCCTAACGCTATG 3'
Amplification Conditions
Annealing temperature = 50
Sequence
BV211413
Source Species
Triticum aestivum
Data Source
Ward, Rick



Locus for Probe
barc121-7A
Type
Microsatellite
Map
KPxKC-7A90.8
Wheat_AB, Latino x MG5323 7A118.7
Wheat_AB_2015_Consensus-7A135.9
[ Show Nearby Loci ]
Map Data
Wheat, Klein Proteo x Klein Chaja
Wheat_AB, Latino x MG5323
Wheat_AB_2015_Consensus
Probe
BARC121
Possible Orthologs
Xbarc121-7A
[ Show all 11 ]



Locus for Probe
barc121
Type
Microsatellite
Map
Durum Wheat, NSGC Lr 7A135.9
Wheat, Yr genes and QTL 7A40.8
Wheat, Yr genes and QTL 7D94
Wheat_Consensus_2014_Ug99_Rust_7A80.37
Wheat_Consensus_2014_Ug99_Rust_7D84.32
[ Show Nearby Loci ]
Map Data
Durum Wheat, NSGC Lr
Wheat, Yr genes and QTL
Wheat_Consensus_2014_Ug99_Rust
Probe
BARC121
Possible Orthologs
Xbarc121-7A
[ Show all 11 ]



Locus for Probe
barc121_1
Type
Microsatellite
Map
Wheat, Yr genes and QTL 7A41.8
Wheat_Consensus_2014_Ug99_Rust_7A75.57
[ Show Nearby Loci ]
Map Data
Wheat, Yr genes and QTL
Wheat_Consensus_2014_Ug99_Rust
Probe
BARC121
Possible Orthologs
Xbarc121-7A
[ Show all 11 ]



Locus for Probe
barc121_2
Type
Microsatellite
Map
Wheat, Yr genes and QTL 7D60.7
Wheat_Consensus_2014_Ug99_Rust_7D11.82
[ Show Nearby Loci ]
Map Data
Wheat, Yr genes and QTL
Wheat_Consensus_2014_Ug99_Rust
Probe
BARC121
Possible Orthologs
Xbarc121-7A
[ Show all 11 ]



Locus for Probe
Xbarc121
Type
Microsatellite
Map
Wheat, Avalon x Cadenza 7A229.7
[ Show Nearby Loci ]
Map Data
Wheat, Avalon x Cadenza
Probe
BARC121
Possible Orthologs
Xbarc121-7A
[ Show all 11 ]



Locus for Probe
barc121-7A.1
Type
Microsatellite
Map
Wheat-2014-Consensus-Ug99-Update_7A75.57
[ Show Nearby Loci ]
Map Data
Wheat-2014-Consensus-Ug99-Update
Probe
BARC121
Possible Orthologs
Xbarc121-7A
[ Show all 11 ]



Locus for Probe
barc121-7A.2
Type
Microsatellite
Map
Wheat-2014-Consensus-Ug99-Update_7A80.37
[ Show Nearby Loci ]
Map Data
Wheat-2014-Consensus-Ug99-Update
Probe
BARC121
Possible Orthologs
Xbarc121-7A
[ Show all 11 ]



Locus for Probe
barc121-7D.1
Type
Microsatellite
Map
Wheat-2014-Consensus-Ug99-Update_7D11.82
[ Show Nearby Loci ]
Map Data
Wheat-2014-Consensus-Ug99-Update
Probe
BARC121
Possible Orthologs
Xbarc121-7A
[ Show all 11 ]



Locus for Probe
barc121-7D.2
Type
Microsatellite
Map
Wheat-2014-Consensus-Ug99-Update_7D84.32
[ Show Nearby Loci ]
Map Data
Wheat-2014-Consensus-Ug99-Update
Probe
BARC121



Locus for Probe
Sr22
Type
Gene
Trait
Chromosome
7A
Chromosome Arm
7AL
Map
Triticum-Genes-7A29.4
Wheat-2014-Consensus-Ug99-Update_7A112
Wheat-Composite2004-7A171
[ Show Nearby Loci ]
Map Data
Wheat genes
Wheat-2014-Consensus-Ug99-Update
2 Point Data
Centromere/Sr22#1
[ Show all 7 ]
Species
Triticum aestivum
Probe
BARC121
CFA2019
CFA2123
WMC633
Associated Gene
Sr22 (Triticum)
Gene Class
Reaction to Puccinia graminis Pers.
Reference
ReferenceYu L et al. (2014) A consensus map for Ug99 stem rust resistance loci in wheat. Theoretical and Applied Genetics 127:1561-1581.
ReferenceKhan RR et al. (2005) Molecular mapping of stem and leaf rust resistance in wheat Theoretical and Applied Genetics 111:846-850.
ReferenceThe TT (1973) Chromosome location of genes conditioning stem rust resistance transferred from diploid to hexaploid wheat. Nature New Biology 241:256.
ReferenceBrown-Guedira G et al. MAS Wheat. Bringing Genomics to the Wheat Fields. Disease resistance. Stem Rust Resistance. Sr22 MAS Wheat. Marker Assisted Selection in Wheat.
Data Source
Matthews, David E.
Remark
Trait marker Xcfa2019-7A
Nearby marker on Composite map: Xgwm282
Position on Composite map estimated by GrainGenes.
The location on the 2014 Ug99 Consensus Map is approximate.



Locus for Probe
Xbarc121-7A
Type
Microsatellite
Chromosome
7A
Map
Chinese_Spring_Deletion_SSR_7A0.195
Louise/Penawawa-7A9.4
Ta-SSR-2004-7A76
Ta-Synthetic/Opata-BARC-7A75.7
[ Show Nearby Loci ]
In QTL
Qfhs.fcu-7AL
Breakpoint Interval
C-7AL1-0.39
Map Data
Wheat, Consensus SSR, 2004
Wheat, Louise x Penawawa
Wheat, Physical, SSR
Wheat, Synthetic x Opata, BARC
Probe
BARC121
Reference
ReferenceSomers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114.
Possible Orthologs
Xbarc121-7D
[ Show all 11 ]



Locus for Probe
Xbarc121-7D
Type
Microsatellite
Chromosome
7D
Map
Ta-SSR-2004-7D106.6
Ta-Synthetic/Opata-BARC-7D82.1
[ Show Nearby Loci ]
Map Data
Wheat, Consensus SSR, 2004
Wheat, Synthetic x Opata, BARC
Probe
BARC121
Reference
ReferenceSomers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114.
Possible Orthologs
Xbarc121-7A
[ Show all 11 ]



Locus for Probe
Xbarc121.2
Type
Microsatellite
Chromosome
7D
Map
Wheat-Composite2004-7D153
[ Show Nearby Loci ]
Map Data
Wheat, Composite, 2004
Probe
BARC121
Possible Orthologs
Xbarc121-7A
[ Show all 11 ]



Locus for Probe
XbarcM121-6D
Type
Microsatellite
Map
Chinese_Spring_Deletion_SSR_6D0.645
[ Show Nearby Loci ]
Breakpoint Interval
6DL6-0.29-1.00*
Map Data
Wheat, Physical, SSR
Probe
BARC121
Remark
'M' indicates that this probe is monomorphic in Synthetic, Opata, and Chinese Spring.
Possible Orthologs
Xbarc121-7A
[ Show all 11 ]

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.