Query (optional)   in Class  

GrainGenes Marker Report: BARE1-5M59

[ Printable Version ]  [ Submit comment/correction ]

Probe
BARE1-5M59
Locus
[ Hide all but 1 of 16 ]
BARE1-5M59i
BARE1-5M59h
BARE1-5M59c
BARE1-5M59l
BARE1-5M59a
BARE1-5M59e
BARE1-5M59p
BARE1-5M59j
BARE1-5M59g
BARE1-5M59f
BARE1-5M59m
BARE1-5M59d
BARE1-5M59b
BARE1-5M59n
BARE1-5M59o
BARE1-5M59q
Reference
ReferenceLeigh F et al. (2003) Comparison of the utility of barley retrotransposon families for genetic analysis by molecular marker techniques Molecular Genetics and Genomics 269:464-474.
Remarks
Position of retroposon-based primer in the LTR = 5' terminus + A
MseI primer (KeyGene code) = CTA (M59)
Type
PCR
STS
PCR primers
BARE-1-5980 5' CTAGGGCATAATTCCAACAA 3'
Mse1 primer M59 5' GATGAGTCCTGAGTAACTA 3'
Amplification Conditions
amplified as Vos et al Nucl Acids Res 23: 4407-4419
Source Species
Hordeum vulgare



Locus for Probe
BARE1-5M59h
Type
SSAP
Chromosome
7H
Map
Hordeum-SxM-SSAP-7H68.7
[ Show Nearby Loci ]
Map Data
Barley, Steptoe x Morex, SSAP
Probe
BARE1-5M59
Reference
ReferenceRodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184.



Locus for Probe
BARE1-5M59i
Type
SSAP
Chromosome
7H
Map
Hordeum-SxM-SSAP-7H21.9
[ Show Nearby Loci ]
Map Data
Barley, Steptoe x Morex, SSAP
Probe
BARE1-5M59
Reference
ReferenceRodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184.



Locus for Probe
BARE1-5M59j
Type
SSAP
Chromosome
3H
Map
Hordeum-SxM-SSAP-3H48.8
[ Show Nearby Loci ]
Map Data
Barley, Steptoe x Morex, SSAP
Probe
BARE1-5M59
Reference
ReferenceRodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184.



Locus for Probe
BARE1-5M59l
Type
SSAP
Chromosome
2H
Map
Hordeum-SxM-SSAP-2H97.7
[ Show Nearby Loci ]
Map Data
Barley, Steptoe x Morex, SSAP
Probe
BARE1-5M59
Reference
ReferenceRodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184.



Locus for Probe
BARE1-5M59m
Type
SSAP
Chromosome
3H
Map
Hordeum-SxM-SSAP-3H64.6
[ Show Nearby Loci ]
Map Data
Barley, Steptoe x Morex, SSAP
Probe
BARE1-5M59
Reference
ReferenceRodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184.



Locus for Probe
BARE1-5M59n
Type
SSAP
Chromosome
1H
Map
Hordeum-SxM-SSAP-1H82.7
[ Show Nearby Loci ]
Map Data
Barley, Steptoe x Morex, SSAP
Probe
BARE1-5M59
Reference
ReferenceRodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184.



Locus for Probe
BARE1-5M59o
Type
SSAP
Chromosome
5H
Map
Hordeum-SxM-SSAP-5H43.3
[ Show Nearby Loci ]
Map Data
Barley, Steptoe x Morex, SSAP
Probe
BARE1-5M59
Reference
ReferenceRodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184.



Locus for Probe
BARE1-5M59p
Type
SSAP
Chromosome
3H
Map
Hordeum-SxM-SSAP-3H6.5
[ Show Nearby Loci ]
Map Data
Barley, Steptoe x Morex, SSAP
Probe
BARE1-5M59
Reference
ReferenceRodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184.



Locus for Probe
BARE1-5M59q
Type
SSAP
Chromosome
5H
Map
Hordeum-SxM-SSAP-5H55.1
[ Show Nearby Loci ]
Map Data
Barley, Steptoe x Morex, SSAP
Probe
BARE1-5M59
Reference
ReferenceRodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184.



Locus for Probe
BARE1-5M59a
Type
SSAP
Chromosome
2H
Map
Hordeum-SxM-SSAP-2H141.4
[ Show Nearby Loci ]
Map Data
Barley, Steptoe x Morex, SSAP
Probe
BARE1-5M59
Reference
ReferenceRodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184.



Locus for Probe
BARE1-5M59b
Type
SSAP
Chromosome
1H
Map
Hordeum-SxM-SSAP-1H39.8
[ Show Nearby Loci ]
Map Data
Barley, Steptoe x Morex, SSAP
Probe
BARE1-5M59
Reference
ReferenceRodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184.



Locus for Probe
BARE1-5M59c
Type
SSAP
Chromosome
2H
Map
Hordeum-SxM-SSAP-2H67
[ Show Nearby Loci ]
Map Data
Barley, Steptoe x Morex, SSAP
Probe
BARE1-5M59
Reference
ReferenceRodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184.



Locus for Probe
BARE1-5M59d
Type
SSAP
Chromosome
4H
Map
Hordeum-SxM-SSAP-4H43.3
[ Show Nearby Loci ]
Map Data
Barley, Steptoe x Morex, SSAP
Probe
BARE1-5M59
Reference
ReferenceRodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184.



Locus for Probe
BARE1-5M59e
Type
SSAP
Chromosome
2H
Map
Hordeum-SxM-SSAP-2H166.1
[ Show Nearby Loci ]
Map Data
Barley, Steptoe x Morex, SSAP
Probe
BARE1-5M59
Reference
ReferenceRodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184.



Locus for Probe
BARE1-5M59f
Type
SSAP
Chromosome
3H
Map
Hordeum-SxM-SSAP-3H53.9
[ Show Nearby Loci ]
Map Data
Barley, Steptoe x Morex, SSAP
Probe
BARE1-5M59
Reference
ReferenceRodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184.



Locus for Probe
BARE1-5M59g
Type
SSAP
Chromosome
3H
Map
Hordeum-SxM-SSAP-3H50.3
[ Show Nearby Loci ]
Map Data
Barley, Steptoe x Morex, SSAP
Probe
BARE1-5M59
Reference
ReferenceRodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184.