Query (optional)   in Class  

GrainGenes Marker Report: Bmag0306b

[ Printable Version ]  [ Submit comment/correction ]

Locus
Bmag0306b
Type
Microsatellite
Synonym
SynonymBmag306
Chromosome
3H
Map
[ Hide all but 1 of 6 ]
Hordeum-Consensus2005-SNP-3H117.44
Hordeum-Consensus2007-SSR-3H104.15
Hordeum-LiHs-SNP-3H108.11
Hordeum-LxHs-3H119
Hordeum-QTLConsensus-Abiotic-3H117.44
Hordeum-QTLConsensus-Agronomic-3H117.44
[ Show Nearby Loci ]
Map Data
Barley, Abiotic QTL Consensus
[ Show all 6 ]
Species
Hordeum spontaneum
Hordeum vulgare
Probe
Bmag0306
Bmag306
Reference
ReferenceVarshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091.
ReferenceRostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
ReferenceRamsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remark
Locus in 'Barley, Consensus 2007, SSR' mapped in population(s) : Lina x H. spontaneum
Insert contains repeat (AG)16
Developing laboratory = SCRI (R. Waugh)
Possible Orthologs
Bmag0306
Bmag306
Bmag0306a



Probe for Locus
Bmag0306
Locus
Bmag0306
Bmag0306b
Bmag0306a
Synonym
Other nameBmag306
Reference
ReferenceHearnden PR et al. (2007) A genetic map of 1,000 SSR and DArT markers in a wide barley cross. Theoretical and Applied Genetics 115:383-391.
ReferenceVarshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091.
ReferenceRamsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Type
SSR
PCR primers
ATGTACAAGTAGCTATGTGTTTGA
CACATCAAGATAACAAGAGAAGA



Probe for Locus
Bmag306
Locus
Bmag0306
Bmag0306b
Bmag0306a
Bmag306
Synonym
Other nameBmag0306
Reference
ReferenceRamsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
General Remarks
Insert contains repeat (AG)16
Quality = 3: Strong major polymorphic product, with additional strong bands. Multi-locus or weak but scoreable products
Type
PCR
SSR
PCR primers
5' ATGTACAAGTAGCTATGTGTTTGA 3'
5' CACATCAAGATAACAAGAGAAGA 3'
SSR size
149
Amplification Conditions
1 cycle of 3 min @ 94C, 1 min @ 58C, 1 min @ 72C, 30 cycles of 30 secs @ 94C, 30 secs @ 58C, 30 secs @ 72C, 1 cycle of 5 mins @ 72C.
Source Species
Hordeum vulgare