Query (optional)   in Class  

GrainGenes Marker Report: Bmag0369

Locus
Bmag0369
Type
Microsatellite
Synonym
SynonymBmag369
Chromosome
7H
Map
Barley, B73xCPI-7H87
[ Show all 7 ]
[ Show Nearby Loci ]
Map Data
Barley, Abiotic QTL Consensus
[ Show all 7 ]
Species
Hordeum spontaneum
Hordeum vulgare
Probe
Bmag0369
Bmag369
Reference
ReferenceVarshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091.
ReferenceRostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
ReferenceRamsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remark
Locus in 'Barley, Consensus 2007, SSR' mapped in population(s) : Lina x H. spontaneum
Insert contains repeat (CT)16
Polymorphic Information Content (PIC) = 0.81
Developing laboratory = SCRI (R. Waugh)
Possible Orthologs
Bmag369



Probe for Locus
Bmag369
Locus
Bmag0369
Bmag369
Synonym
Other nameBmag0369
Reference
ReferenceRamsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
General Remarks
Insert contains repeat (CT)16
Quality = 2: Single product, relatively strong stutter bands
Diversity Index (DI) = 0.81
Type
PCR
SSR
PCR primers
5' CACTAGGCACCAATGACTG 3'
5' ATCGAAAATCTTAGCTTTGG 3'
SSR size
191
Amplification Conditions
1 cycle of 3 min @ 94C, 1 min @ 58C, 1 min @ 72C, 30 cycles of 30 secs @ 94C, 30 secs @ 58C, 30 secs @ 72C, 1 cycle of 5 mins @ 72C.
Source Species
Hordeum vulgare



Probe
Bmag0369
Locus
Bmag0369
Synonym
Other nameBmag369
Reference
ReferenceHearnden PR et al. (2007) A genetic map of 1,000 SSR and DArT markers in a wide barley cross. Theoretical and Applied Genetics 115:383-391.
ReferenceVarshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091.
ReferenceRamsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Type
SSR
PCR primers
CACTAGGCACCAATGACTG
ATCGAAAATCTTAGCTTTGG