Query (optional)   in Class  

GrainGenes Marker Report: Bmag0535

Locus
Bmag0535
Type
Microsatellite
Map
Barley, B73xCPI-1H50.9
[ Show Nearby Loci ]
Map Data
Barley, B73xCPI
Probe
Bmag0535
Possible Orthologs
Bmag535



Probe
Bmag0535
Locus
Bmag0535
Synonym
Other nameBmag535
Reference
ReferenceHayden MJ et al. (2008) Multiplex-Ready PCR: A new method for multiplexed SSR and SNP genotyping BMC Genomics 9:80.
PCR primers
Forward ACAAAGCTGGTAATACATCAAG
Reverse TAAACTTCATGACGTGACATC