Query (optional)   in Class  

GrainGenes Marker Report: MAG1810

Probe
MAG1810
Locus
Xmag1810
Reference
ReferenceXue S et al. (2008) A high-density intervarietal map of the wheat genome enriched with markers derived from expressed sequence tags. Theoretical and Applied Genetics 117:181-189.
Type
STS
PCR primers
Forward TTAGGAAGGAGGTCTTGCTCTGC
Reverse CGGAAAACAACAACGAAGCG
Amplification Conditions
Anneal 55
Sequence
BQ169730
Source Species
Triticum aestivum
Clone Location
Ma, Zhengqiang



Locus for Probe
Xmag1810
Type
Microsatellite
Map
Ta-NxW-7A263.5
[ Show Nearby Loci ]
Map Data
Wheat, Nanda2419 x Wangshuibai
Probe
MAG1810