Query (optional)   in Class  

GrainGenes Marker Report: MWG632

[ Printable Version ]  [ Submit comment/correction ]

Locus
MWG632
Type
RFLP
Map
Barley-Consensus2-5H192.8
Hordeum-HxT-base-5H235.6
Hordeum-NABGMP2-5H245.8
[ Show Nearby Loci ]
QTL with Locus Marker
QAa.HaTR-5H
[ Show all 10 ]
Map Data
Barley consensus 2
Barley, HxT
Barley, HxT basemap
Probe
MWG632
Possible Orthologs
MWG632a
[ Show all 7 ]



Probe
MWG632
Locus
MWG632b
[ Show all 8 ]
Synonym
SynonymHAR35_730
Type
Genomic
STS
STS primers
5' CAACAGCAGCACAAGGTCGCTGCCT
5' GGTGGAAGCCAAGTCTGACATCGTC
STS size
473
Amplification Conditions
STS annealing temperature 55-58 oC
Sequence
AJ234546
MWG632-5
Polymorphism
[ Hide all but 1 of 6 ]
MWG632 EcoRI
MWG632 EcoRV
MWG632 BamHI
MWG632 DraI
MWG632 HindIII
MWG632 XbaI
Insert Enzyme
PstI
Source Species
Hordeum vulgare
Clone Vector
Bluescript
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Graner, Andreas
Clone Authority
Graner, Andreas
Image
MWG632 BROWSSM autoradiogram
MWG632 SO autoradiogram
Data Source
Graner, Andreas94.03.08
Kuenzel, Gottfried00.03



Locus for Probe
mwg632
Type
RFLP
Map
Wheat, Yr genes and QTL 1A76.1
[ Show Nearby Loci ]
Map Data
Wheat, Yr genes and QTL
Probe
MWG632
Possible Orthologs
MWG632
[ Show all 7 ]



Locus for Probe
MWG632a
Type
RFLP
Chromosome
3H
Map
Barley-Consensus2-3H101.9
Hordeum-Bins-3H156
Hordeum-Graner2-3H126.6
Hv-Consensus2006-Marcel-3H128.99
Hv-Integrated2009-3H139.2
[ Show Nearby Loci ]
Map Data
Barley consensus 2
Barley, BinMap 2005
Barley, Consensus 2006, Marcel
Barley, Integrated, Marcel 2009
Barley, IxF
Probe
MWG632
Data Source
Kleinhofs, Andris
Remark
This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin
Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb'
Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Igri x Franka
Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Igri x Franka
Possible Orthologs
MWG632
[ Show all 7 ]



Locus for Probe
MWG632b
Type
RFLP
Chromosome
1H
Map
Barley-Consensus2-1H140.9
[ Show all 7 ]
[ Show Nearby Loci ]
Map Data
Barley consensus 2
[ Show all 7 ]
Species
Hordeum vulgare
Probe
MWG632
Reference
ReferenceVarshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091.
Data Source
Kleinhofs, Andris
Remark
This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin
Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb'
Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Igri x Franka
Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Igri x Franka
Locus in 'Barley, Consensus 2007, SSR' was a BIN marker in 'Barley, Consensus 2006, Marcel'
Possible Orthologs
MWG632
[ Show all 7 ]



Locus for Probe
MWG632C
Type
RFLP
Chromosome
5H
Map
Hordeum-Bins-5H191
Hordeum-FxS-FHB-QTL-5H249.1
[ Show Nearby Loci ]
Map Data
Barley, BinMap 2005
Barley, FxS, FHB QTL
Probe
MWG632
Reference
ReferenceMesfin A et al. (2003) Quantitative trait loci for fusarium head blight resistance in barley detected in a two-rowed by six-rowed population Crop Science 43:307-318.
Data Source
Kleinhofs, Andris
Remark
This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin
Possible Orthologs
MWG632
[ Show all 7 ]



Locus for Probe
Xmwg632
Type
RFLP
Chromosome
1A
Map
Wheat-Composite2004-1A118
[ Show Nearby Loci ]
Map Data
Wheat, Composite, 2004
Probe
MWG632
Possible Orthologs
MWG632
[ Show all 7 ]



Locus for Probe
Xmwg632-1
Type
RFLP
Chromosome Arm
1L
Map
Triticeae-Sorrells-1149
[ Show Nearby Loci ]
Map Data
Triticeae consensus
Probe
MWG632
Possible Orthologs
MWG632
[ Show all 7 ]



Locus for Probe
Xmwg632-1A
Type
RFLP
Chromosome
1A
Chromosome Arm
1AL
Map
Ta-Synthetic/Opata-1A144.8
[ Show all 6 ]
[ Show Nearby Loci ]
Map Data
Wheat, Synthetic x Opata  [ GBrowser ]
[ Show all 6 ]
Probe
MWG632
Image
MWG632 SO autoradiogram
Possible Orthologs
MWG632
[ Show all 7 ]