Query (optional)   in Class  

GrainGenes Marker Report: Xcfd49-6D

[Submit comment/correction]

Locus
Xcfd49-6D
Type
Microsatellite
Chromosome
6D
Chromosome Arm
6DS
Map
Chinese_Spring_Deletion_SSR_6D-0.995
[ Show all 6 ]
[ Show Nearby Loci ]
Breakpoint Interval
6DS6-0.99-1.00
Map Data
Wheat, Arina x Forno
[ Show all 6 ]
Species
Triticum aestivum
Probe
CFD49
Reference
ReferenceSomers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114.
ReferencePaillard S et al. (2003) An integrative genetic linkage map of winter wheat (Triticum aestivum L.) Theoretical and Applied Genetics 107:1235-1242.
Possible Orthologs
Xcfd49
cfd49
Xcfd49a



Probe for Locus
CFD49
Locus
Xcfd49-6D
Xcfd49
cfd49-6D
SrTA10187
cfd49
Reference
ReferenceOlson EL et al. (2013) Introgression of stem rust resistance gene SrTA10187 and SrTA10171 from Aegilops tauschii to wheat Theoretical and Applied Genetics 126:2477-2484.
ReferenceGuyomarc'h H et al. (2002) Characterisation of polymorphic microsatellite markers from Aegilops tauschii and transferability to the D-genome of bread wheat Theoretical and Applied Genetics 104:1164-1172.
ReferenceMAS Wheat. Bringing Genomics to the Wheat Fields. Disease Resistance. Stem Rust Resistance. SrTA10187 MAS Wheat. Marker Assisted Selection in Wheat.
General Remarks
Quality Score = A
Quality scores reflect the quality of amplification (from A very good quality to D multiple banding pattern : A and B can be used on capillary systems)
Amplifies motif: (GA)33
Regularity of motif is imperfect
Type
PCR
SSR
PCR primers
Forward 5' TGAGTTCTTCTGGTGAGGCA 3'
Reverse 5' GAATCGGTTCACAAGGGAAA 3'
SSR size
214
Amplification Conditions
5 minutes at 94 degrees; 30 cycles (94 degrees for 30 seconds; 60 degrees for 30 seconds; 72 degrees for 30 seconds); 10 minutes at 72 degrees
Linkage Group
6D
Source Species
Aegilops tauschii
Data Source
Sourdille, Pierre

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.