Query (optional)   in Class  

GrainGenes Marker Report: Xcfd71a

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xcfd71a
Type
Microsatellite
Chromosome
4D
Map
Wheat-Composite2004-4D43
[ Show Nearby Loci ]
Map Data
Wheat, Composite, 2004
Probe
CFD71
Possible Orthologs
[ Hide all but 1 of 6 ]
Xcfd71-4A
Xcfd71-4D
cfd71
Xcfd71
cfd71-4D
cfd71-4A



Probe for Locus
CFD71
Locus
Xcfd71-4D
[ Show all 8 ]
Reference
ReferenceHiebert CW et al. (2010) An introgression on wheat chromosome 4DL in RL6077 (Thatcher*6/PI 250413) confers adult plant resistance to stripe rust and leaf rust (Lr67) Theoretical and Applied Genetics 121:1083-1091.
ReferenceGuyomarc'h H et al. (2002) Characterisation of polymorphic microsatellite markers from Aegilops tauschii and transferability to the D-genome of bread wheat Theoretical and Applied Genetics 104:1164-1172.
ReferenceHiebert CW MAS Wheat. Bringing Genomics to the Wheat Fields. Disease Resistance. Leaf Rust Resistance. Lr67 MAS Wheat. Marker Assisted Selection in Wheat.
General Remarks
Quality Score = B
Quality scores reflect the quality of amplification (from A very good quality to D multiple banding pattern : A and B can be used on capillary systems)
Amplifies motif: (CA)10(GA)30
Regularity of motif is perfect
Type
PCR
SSR
PCR primers
Forward 5' CAATAAGTAGGCCGGGACAA 3'
Reverse 5' TGTGCCAGTTGAGTTTGCTC 3'
SSR size
216
Amplification Conditions
5 minutes at 94 degrees; 30 cycles (94 degrees for 30 seconds; 60 degrees for 30 seconds; 72 degrees for 30 seconds); 10 minutes at 72 degrees
Linkage Group
4D/4A
Source Species
Aegilops tauschii
Data Source
Sourdille, Pierre