Query (optional)   in Class  

GrainGenes Marker Report: Xcmwg649.2

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xcmwg649.2
Type
RFLP
Map
Avena-Sorrells-B86
[ Show Nearby Loci ]
Map Data
Diploid Oat, Cornell2
Probe
cMWG649
Possible Orthologs
cMWG649
[ Show all 7 ]



Probe for Locus
cMWG649
Locus
[ Hide all but 1 of 10 ]
cMWG649b
cMWG649a
cMWG649c
RI026K23
RI016M10
Xcmwg649.1
Xcmwg649.2
cMWG649b-1H
cMWG649a-7H
cMWG649
Synonym
Other nameMWG649
ReferenceGraner A et al. (1991) Construction of an RFLP map of barley Theoretical and Applied Genetics 83:250-256.
MWG649
ReferenceKunzel G et al. (2000) Integration of deletion breakpoints of chromosome 7H (1) into the Igri/Franka-derived RFLP Barley Genetics Newsletter 30:24-27.
SynonymHAR35_4916
Reference
ReferenceGraner A et al. (1991) Construction of an RFLP map of barley Theoretical and Applied Genetics 83:250-256.
Type
cDNA
STS
STS primers
5' CAACACTCCGTCAACCAGCAACCTC
5' GCCTGCGTTGTTGAATGCG
STS size
441
Amplification Conditions
STS annealing temperature 55-58 oC
Sequence
AJ234403
CMWG649-5
DNA Library
cMWG
Source Species
Hordeum vulgare
Source Tissue
Leaf
Clone Vector
Bluescript
Clone Location
GrainGenes Probe Repository
Graner, Andreas
Clone Authority
Graner, Andreas
Data Source
Graner, Andreas94.03.08
Stein, Nils2006.10
Kuenzel, Gottfried00.03