Query (optional)   in Class  

GrainGenes Marker Report: Xgwm190-5D

Locus
Xgwm190-5D
Type
Microsatellite
Chromosome
5D
Chromosome Arm
5DS
Map
Chinese_Spring_Deletion_SSR_5D-0.315
[ Show all 8 ]
[ Show Nearby Loci ]
Breakpoint Interval
C-5DS1-0.63
Map Data
Wheat, Arina x Forno
[ Show all 8 ]
Species
Triticum aestivum
Probe
WMS190
Reference
ReferenceSomers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114.
ReferencePaillard S et al. (2003) An integrative genetic linkage map of winter wheat (Triticum aestivum L.) Theoretical and Applied Genetics 107:1235-1242.
ReferenceRoder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023.
Data Source
Roeder, Marion S.98.09.15
Remark
In Map Ta-Synthetic/Opata-SSR-5D, the interval most likely to contain locus is distal to Xfba393
Possible Orthologs
Xgwm190
gwm190



Probe for Locus
WMS190
Locus
Xgwm190-5D
Xgwm190
gwm190
Reference
ReferenceRoder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023.
General Remarks
Insert contains repeat (CT)22
PRIMER SEQUENCE IS AVAILABLE FOR PUBLIC RESEARCH ONLY. REQUESTS FOR COMMERCIAL USE SHOULD BE DIRECTED TO M. ROEDER.
Type
PCR
SSR
PCR primers
5' GTGCTTGCTGAGCTATGAGTC 3'
5' GTGCCACGTGGTACCTTTG 3'
Amplification Conditions
3 min at 94 deg C; 45 cycles with 1 min at 94 deg C, 1 min at 60 deg C, and 2 min at 72 deg C; and a final extension step of 10 min at 72 deg C
Polymorphism
WMS190
Source Species
Triticum aestivum
Source Germplasm
Chinese Spring
Data Source
Roeder, Marion S.98.09.15