Query (optional)   in Class  

GrainGenes Marker Report: XksuH16-2A

[ Printable Version ]  [ Submit comment/correction ]

Locus
XksuH16-2A
Type
RFLP
Chromosome
2A
Chromosome Arm
2AL
Map
Ta-Gale-2A61.6
[ Show all 7 ]
[ Show Nearby Loci ]
QTL with Locus Marker
QFhs.ndsu-2A
QFhs.ndsu.2A
Map Data
Wheat, Gale
[ Show all 7 ]
Probe
pTtksuH16
QTL Linked with Locus
QFhs.ndsu-2A
Image
KSUH16 SO autoradiogram
Reference
ReferenceWaldron BL et al. (1999) RFLP mapping of QTL for Fusarium head blight resistance in wheat Crop Science 39:805-811.
Possible Orthologs
H016
[ Show all 7 ]



Probe for Locus
pTtksuH16
Locus
[ Hide all but 1 of 10 ]
XksuH16
DGH16
XksuH16-2A
XksuH16-2D
Xksu.DGH16
H016
ksuH16
XksuH16-2B
ksuH16-6B
XksuH16-2
Reference
ReferenceGill KS et al. (1991) A genetic linkage map of Triticum tauschii (DD) and its relationship to the D genome of bread wheat (AABBDD). Genome 34:362-374.
Type
Genomic
STS
PCR primers
R:CACCTTCTTCTTCTTCTACT
L:ACACTCTTCATTGGCATCTC
Polymorphism
KSUH16 EcoRV
[ Show all 6 ]
Linkage Group
2D
Insert Enzyme
PstI
Source Species
Triticum tauschii
Insert Size
0.4
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Image
KSUH16 SO autoradiogram
Data Source
Talbert, Luther E.94.09.12
ATMI92.09
Gill, Bikram S.92.09