Query (optional)   in Class  

GrainGenes Marker Report: Xmwg2053c

Locus
Xmwg2053c
Type
RFLP
Chromosome
6D
Map
Wheat-Composite2004-6D162
[ Show Nearby Loci ]
Map Data
Wheat, Composite, 2004
Probe
MWG2053
Possible Orthologs
MWG2053
[ Show all 11 ]



Probe for Locus
MWG2053
Locus
MWG2053
[ Show all 13 ]
Type
Genomic
STS
STS primers
5' CCCCGGTATCCTCAAATGCA
5' GTTTTCGCGACGATGTCCTT
STS size
ca. 1350
Amplification Conditions
STS annealing temperature 55-58 oC
Sequence
BH854313
BH854314
MWG2053-5
MWG2053-3
Insert Enzyme
PstI
Source Species
Hordeum vulgare
Clone Vector
Bluescript
Excision Enzyme
PstI
Clone Location
Graner, Andreas
Clone Authority
Graner, Andreas
Data Source
Graner, Andreas94.03.08
Kuenzel, Gottfried00.03