Query (optional)   in Class  

GrainGenes Marker Report: Xmwg920-1A.1

Locus
Xmwg920-1A.1
Type
RFLP
Map
Tm-Dubcovsky2-1A-56.4
[ Show Nearby Loci ]
Map Data
T. monococcum, DV92 x G3116
Probe
MWG920
Remark
In the population 'T. monococcum, DV92 x G3116,' this locus and Xmwg835-1A.1 were mapped with identical restriction fragments, so the corresponding clones are assumed to be homologous.
Possible Orthologs
MWG920
[ Show all 13 ]



Probe for Locus
MWG920
Locus
MWG920
[ Show all 20 ]
Reference
ReferenceGraner A et al. (1991) Construction of an RFLP map of barley Theoretical and Applied Genetics 83:250-256.
Type
Genomic
STS
STS primers
5' GTCACCGCCCGTCACGTTGCGCTTCA
5' GAGTACCGCGACCGTCGCGCTCGAGC
STS size
183
Amplification Conditions
STS annealing temperature 58-60 oC
Sequence
AJ234647
MWG920-5
Insert Enzyme
PstI
Source Species
Hordeum vulgare
Clone Vector
Bluescript
Excision Enzyme
PstI
Clone Location
Graner, Andreas
Clone Authority
Graner, Andreas
Data Source
Graner, Andreas94.03.08
Kuenzel, Gottfried00.03