Query (optional)   in Class  

GrainGenes Marker Report: scssr08238

[ Printable Version ]  [ Submit comment/correction ]

Locus
scssr08238
Type
Microsatellite
SNP
Synonym
Other nameCtig709
SynonymABC08238_L01R01
Chromosome
1H
Map
[ Hide all but 1 of 8 ]
Barley, B73xCPI-1H129.7
Hordeum-Consensus2005-SNP-1H150.515
Hordeum-Consensus2007-SSR-1H139.81
Hordeum-OWB-2005-1H136.2
Hordeum-OWB-SNP-1H136.17
Hordeum-QTLConsensus-Abiotic-1H150.51
Hordeum-QTLConsensus-Agronomic-1H150.51
Hv-Integrated2009-1H141.7
[ Show Nearby Loci ]
Map Data
[ Hide all but 1 of 8 ]
Barley, Abiotic QTL Consensus
Barley, Agronomic QTL Consensus
Barley, B73xCPI
Barley, Consensus 2005, SNP
Barley, Consensus 2007, SSR
Barley, Integrated, Marcel 2009
Barley, OWB, 2005
Barley, OWB, SNP
Species
Hordeum vulgare
Probe
ABC08238_L01R01
scssr08238
Reference
ReferenceVarshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091.
ReferenceRostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
ReferenceRamsay L et al. (2004) Variation shown by molecular markers in barley: genomic and genetic contraints Aspects of Applied Biology 72:146-154.
Data Source
Russell, Joanne
Remark
Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb'
Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Oregon Wolfe Barleys
Locus in 'Barley, Consensus 2007, SSR' mapped in population(s) : OWBrecessive x OWBdominant
Insert contains repeat (CAA)12
Developing laboratory = SCRI (R. Waugh)



Probe for Locus
ABC08238_L01R01
Locus
scssr08238
Data at Germinate
ABC08238
Data at PLEXdb
Barley1_08238
General Remarks
Estimated product size = 191
BarleySNP type = Contig Indel
Technology platform used = Radioisotope Labelled PCR Separation
Affymetrix contig name = abc08238
PCR primers
5' CAGCAGCAGATCAAATCAGG
5' TACTCTTCTCTTGGCCTTGG
Sequence
Barley1_08238
Source Species
Hordeum vulgare
Data Source
Russell, Joanne



Probe
scssr08238
Locus
scssr08238
Reference
ReferenceVarshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091.
ReferenceHearnden PR et al. (2007) A genetic map of 1,000 SSR and DArT markers in a wide barley cross. Theoretical and Applied Genetics 115:383-391.
ReferenceRamsay L et al. (2004) Variation shown by molecular markers in barley: genomic and genetic contraints Aspects of Applied Biology 72:146-154.
Type
SSR
EST
PCR primers
CAGCAGCAGATCAAATCAGG
TACTCTTCTCTTGGCCTTGG